plvx puro (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
96
Structured Review
TaKaRa
plvx puro
Plvx Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 3506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plvx+puro/Puromycin/bio_rxiv__64898__2026__04__22__720056-320-24-25
Average 96 stars, based on 3506 article reviews
Plvx Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 3506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plvx+puro/Puromycin/bio_rxiv__64898__2026__04__22__720056-320-24-25
Average 96 stars, based on 3506 article reviews
plvx puro - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Highly networked immunogen composition Article Snippet: .. Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), Article Title: Dolichol biosynthesis in yeast traces the expanded reaction pathway of higher eukaryotes Article Snippet: The quantification was performed by Agilent MassHunter Quantitative Analysis software (Agilent Technologies, CA, USA). .. Recombinant lentiviruses were produced in HEK293T cells as previously described using the vectors pUB81 TDA5. pUB81 is a lentiviral expression vector based on the Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. To generate HepG2-NTCP-C4 stably expressing HBV-RADARS reporter, the reporter segment of HBV-RADARS plasmid was PCR amplified using primers ATCGGAATTCTAGCGTTTAAACTTAAGCTT and TATGGCTGATTATGATCTCTAGTCAGGTTTAAACGGGCCCTCTAG , followed by EcoRI and XbaI restriction digestion before ligating into the Amplification:Article Title: Mechanisms of resistance to VHL loss-induced genetic and pharmacological vulnerabilities Article Snippet: .. HIF1A cDNA was amplified from HA-Clover-HIF-1alpha Wild-type (Addgene#163365). Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. To generate HepG2-NTCP-C4 stably expressing HBV-RADARS reporter, the reporter segment of HBV-RADARS plasmid was PCR amplified using primers ATCGGAATTCTAGCGTTTAAACTTAAGCTT and TATGGCTGATTATGATCTCTAGTCAGGTTTAAACGGGCCCTCTAG , followed by EcoRI and XbaI restriction digestion before ligating into the Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. Plasmids were constructed by PCR amplification of the HBV-RADARS backbone with primers F4 and R4, insertion of eGFP synthesized from IDT , or insertion of Puro r that is PCR amplified from Construct:Article Title: Mechanisms of resistance to VHL loss-induced genetic and pharmacological vulnerabilities Article Snippet: .. HIF1A cDNA was amplified from HA-Clover-HIF-1alpha Wild-type (Addgene#163365). Article Title: MicroRNA-124-3p suppresses lung cancer by targeting ITGB1/PI3K/p-AKT signal transduction pathway. Article Snippet: Worldwide, lung cancer is a leading cause of cancer-related death, and non-small cell lung cancer (NSCLC) represents the most common histological subtype.. Numerous studies have demonstrated that microRNAs (miRNAs) play critical roles in NSCLC pathogenesis. microRNA-124–3p (miR-124–3p) has been identified as a tumor-associated miRNA, and we confirmed its downregulation in NSCLC cells.. Functional assays showed that overexpression of miR-124–3p suppresses proliferation and migration of NSCLC cells, whereas its knockdown promotes these malignant phenotypes. Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. Plasmids were constructed by PCR amplification of the HBV-RADARS backbone with primers F4 and R4, insertion of eGFP synthesized from IDT , or insertion of Puro r that is PCR amplified from Generated:Article Title: Mechanisms of resistance to VHL loss-induced genetic and pharmacological vulnerabilities Article Snippet: .. HIF1A cDNA was amplified from HA-Clover-HIF-1alpha Wild-type (Addgene#163365). Clone Assay:Article Title: Mechanisms of resistance to VHL loss-induced genetic and pharmacological vulnerabilities Article Snippet: .. HIF1A cDNA was amplified from HA-Clover-HIF-1alpha Wild-type (Addgene#163365). Article Title: Ionic Regulation of Mechanosurveillance and Metastasis via the MRTFA/KCNMB1 Axis Article Snippet: For doxycycline-inducible cell line generation, pLVX-TetON-Advanced (rtTA) (Takara Bio, #632162) was used. .. To over express YAP (Addgene #33091) and its active mutant YAP 5SA (Addgene #33093) were cloned into Modification:Article Title: Mechanisms of resistance to VHL loss-induced genetic and pharmacological vulnerabilities Article Snippet: .. HIF1A cDNA was amplified from HA-Clover-HIF-1alpha Wild-type (Addgene#163365). Expressing:Article Title: MicroRNA-124-3p suppresses lung cancer by targeting ITGB1/PI3K/p-AKT signal transduction pathway. Article Snippet: Worldwide, lung cancer is a leading cause of cancer-related death, and non-small cell lung cancer (NSCLC) represents the most common histological subtype.. Numerous studies have demonstrated that microRNAs (miRNAs) play critical roles in NSCLC pathogenesis. microRNA-124–3p (miR-124–3p) has been identified as a tumor-associated miRNA, and we confirmed its downregulation in NSCLC cells.. Functional assays showed that overexpression of miR-124–3p suppresses proliferation and migration of NSCLC cells, whereas its knockdown promotes these malignant phenotypes. Article Title: Dolichol biosynthesis in yeast traces the expanded reaction pathway of higher eukaryotes Article Snippet: The quantification was performed by Agilent MassHunter Quantitative Analysis software (Agilent Technologies, CA, USA). .. Recombinant lentiviruses were produced in HEK293T cells as previously described using the vectors pUB81 TDA5. pUB81 is a lentiviral expression vector based on the Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. To generate HepG2-NTCP-C4 stably expressing HBV-RADARS reporter, the reporter segment of HBV-RADARS plasmid was PCR amplified using primers ATCGGAATTCTAGCGTTTAAACTTAAGCTT and TATGGCTGATTATGATCTCTAGTCAGGTTTAAACGGGCCCTCTAG , followed by EcoRI and XbaI restriction digestion before ligating into the Cloning:Article Title: MicroRNA-124-3p suppresses lung cancer by targeting ITGB1/PI3K/p-AKT signal transduction pathway. Article Snippet: Worldwide, lung cancer is a leading cause of cancer-related death, and non-small cell lung cancer (NSCLC) represents the most common histological subtype.. Numerous studies have demonstrated that microRNAs (miRNAs) play critical roles in NSCLC pathogenesis. microRNA-124–3p (miR-124–3p) has been identified as a tumor-associated miRNA, and we confirmed its downregulation in NSCLC cells.. Functional assays showed that overexpression of miR-124–3p suppresses proliferation and migration of NSCLC cells, whereas its knockdown promotes these malignant phenotypes. Sequencing:Article Title: MicroRNA-124-3p suppresses lung cancer by targeting ITGB1/PI3K/p-AKT signal transduction pathway. Article Snippet: Worldwide, lung cancer is a leading cause of cancer-related death, and non-small cell lung cancer (NSCLC) represents the most common histological subtype.. Numerous studies have demonstrated that microRNAs (miRNAs) play critical roles in NSCLC pathogenesis. microRNA-124–3p (miR-124–3p) has been identified as a tumor-associated miRNA, and we confirmed its downregulation in NSCLC cells.. Functional assays showed that overexpression of miR-124–3p suppresses proliferation and migration of NSCLC cells, whereas its knockdown promotes these malignant phenotypes. Recombinant:Article Title: Dolichol biosynthesis in yeast traces the expanded reaction pathway of higher eukaryotes Article Snippet: The quantification was performed by Agilent MassHunter Quantitative Analysis software (Agilent Technologies, CA, USA). .. Recombinant lentiviruses were produced in HEK293T cells as previously described using the vectors pUB81 TDA5. pUB81 is a lentiviral expression vector based on the Article Title: Dominant spinal muscular atrophy linked mutations in the cargo binding domain of BICD2 result in altered interactomes and dynein hyperactivity Article Snippet: Recombinant DNA reagent , pEGFP-C3 , Clontech , Discontinued by manufacturer , . .. Recombinant DNA reagent , Produced:Article Title: Dolichol biosynthesis in yeast traces the expanded reaction pathway of higher eukaryotes Article Snippet: The quantification was performed by Agilent MassHunter Quantitative Analysis software (Agilent Technologies, CA, USA). .. Recombinant lentiviruses were produced in HEK293T cells as previously described using the vectors pUB81 TDA5. pUB81 is a lentiviral expression vector based on the Stable Transfection:Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. To generate HepG2-NTCP-C4 stably expressing HBV-RADARS reporter, the reporter segment of HBV-RADARS plasmid was PCR amplified using primers ATCGGAATTCTAGCGTTTAAACTTAAGCTT and TATGGCTGATTATGATCTCTAGTCAGGTTTAAACGGGCCCTCTAG , followed by EcoRI and XbaI restriction digestion before ligating into the Polymerase Chain Reaction:Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. To generate HepG2-NTCP-C4 stably expressing HBV-RADARS reporter, the reporter segment of HBV-RADARS plasmid was PCR amplified using primers ATCGGAATTCTAGCGTTTAAACTTAAGCTT and TATGGCTGATTATGATCTCTAGTCAGGTTTAAACGGGCCCTCTAG , followed by EcoRI and XbaI restriction digestion before ligating into the Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. Plasmids were constructed by PCR amplification of the HBV-RADARS backbone with primers F4 and R4, insertion of eGFP synthesized from IDT , or insertion of Puro r that is PCR amplified from Synthesized:Article Title: A hepatitis B virus RNA-sensing and RNA-editing-dependent reporter system Article Snippet: .. Plasmids were constructed by PCR amplification of the HBV-RADARS backbone with primers F4 and R4, insertion of eGFP synthesized from IDT , or insertion of Puro r that is PCR amplified from Mutagenesis:Article Title: Ionic Regulation of Mechanosurveillance and Metastasis via the MRTFA/KCNMB1 Axis Article Snippet: For doxycycline-inducible cell line generation, pLVX-TetON-Advanced (rtTA) (Takara Bio, #632162) was used. .. To over express YAP (Addgene #33091) and its active mutant YAP 5SA (Addgene #33093) were cloned into |